Materials mutation system (ARMS-PCR )method which uses four

Materials and MethodsIn this study, Genomic DNA was isolated from 5ml peripheral blood leukocytes using salting outmethod from 50 AML patients cases and 50 healthy controls subjects from north-west of IRAN between 2017 and 2018. Before taking samples from AML patients and controlshad provided written formed consent for testing on DNA samples.The genotypes ofthe WT1 A>G (rs16754) polymorphism and MEG3 A>G(rs11160608) wasdetermined by an amplificationrefractory mutation system (ARMS-PCR )method which uses four primer sets.Genotyping of two polymorphisms of MEG3consist of rs3087918 and  rs7158663 wasdetermined using PCR-based restriction fragment length polymorphism (RFLP)method.

All pair primers for PCR in this study were designed by primer 3 and we provided all enzymes from NEB CUTTER.The PCR reaction was carried out in theDNA thermal cycler.For analyzing data we used Statistical Package for SocialScience (SPSS) program version 15.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

MEG3 A>C ( rs3087918)Forwardprimer used for rs3087918 was 5′- CCCCAAGGTCTCAGCACTAA -3′, and also the reverse primer was 5’AACCCCTGTTCCCTGAGTTC-3′.PCRconditions were 96°C for 6min for initial denaturation, followed by 35cyclesof 96°C for 30 s, the annealing temperaturewas 62°C for 30 sand 72°C for 30 s Thefinal extension was at 72°C for 5min. restriction enzyme Fnu4HI used for digestion of amplified PCR product (577 bp). The DNAfragments were electrophoresed through a 2% agarose gel and stained with ethidiumbromide.this enzyme digestthe PCR product in Mutant and normalmode So that in the normal state produced three fragments of 48,101 and 428 bp that It does not cut SNP site.  But in the mutant state, it cuts SNPsite and produced four fragments of 48 and 101, 154 and 274 bp. Theheterozygous genotype produced five bands of48, 101, 154, 274 and 428 bp.

MEG3 A>G (rs7158663)using  primers,F: 5′-CGAACTGAGCCAATGAGAGC-3 and R:  5′- TAGGAACACAACGGGACACA -3′.  The computerized thermal cycler wasprogrammed for the following conditions: an initial denaturation at 96°Cfor  6  min, followedby 35cycles of 96°C for 30 s, annealing at 62°C (30 s), andextension at  72°C (30 s),  final extension72 for 5 min.restrictionenzyme BtsCI used for digestionof amplified PCR product (549 bp). BtsCI treatedPCR products were detected byelectrophoresis on a 2%agarose gel, stained with ethidium bromide.

Itcuts SNP site and produced four fragments of 46 and 76, 115 and 312 bp in normal state.ithas three Cutting positions in the mutant state andproduces 76, 115 and 358 bp fragments. Theheterozygous genotype produced six bands of 46, 76, 115, 312 and 358 bp.