Materials mutation system (ARMS-PCR )method which uses four

Materials and Methods

In this study, Genomic DNA was isolated from 5ml peripheral blood leukocytes using salting out
method from 50 AML patients cases and 50 healthy controls subjects from north-west of IRAN between 2017 and 2018. Before taking samples from AML patients and controls
had provided written formed consent for testing on DNA samples.The genotypes of
the WT1 A>G (rs16754) polymorphism and MEG3 A>G(rs11160608) was
determined by an amplification
refractory mutation system (ARMS-PCR )method which uses four primer sets.Genotyping of two polymorphisms of MEG3
consist of rs3087918 and  rs7158663 was
determined using PCR-based restriction fragment length polymorphism (RFLP)
method.All pair primers for PCR in this study were designed by primer 3 and we provided all enzymes from NEB CUTTER.The PCR reaction was carried out in the
DNA thermal cycler.For analyzing data we used Statistical Package for Social
Science (SPSS) program version 15.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

MEG3 A>C ( rs3087918)

Forward
primer used for rs3087918 was

 5′- CCCCAAGGTCTCAGCACTAA -3′, and also the reverse primer was 5’AACCCCTGTTCCCTGAGTTC-3′.

PCR
conditions were 96°C for 6min for initial denaturation, followed by 35cycles
of 96°C for 30 s, the annealing temperature
was 62°C for 30 s
and 72°C for 30 s The
final extension was at 72°C for 5
min. restriction enzyme Fnu4HI used for digestion of amplified PCR product (577 bp). The DNA
fragments were electrophoresed through a 2% agarose gel and stained with ethidium
bromide.this enzyme digest
the PCR product in Mutant and normal
mode So that in the normal state produced three fragments of 48,
101 and 428 bp that It does not cut SNP site.  But in the mutant state, it cuts SNP
site and produced four fragments of 48 and 101, 154 and 274 bp. The
heterozygous genotype produced five bands of
48, 101, 154, 274 and 428 bp.

MEG3 A>G (rs7158663)

using  primers,F: 5′-CGAACTGAGCCAATGAGAGC-3 and 
R:  5′- TAGGAACACAACGGGACACA -3′.

  The computerized thermal cycler was
programmed for the following conditions: an initial denaturation at 96°Cfor  6  min, followed
by 35cycles of 96°C for 30 s, annealing at 62°C (30 s), and
extension at  72°C 
(30 s),  final extension72 for 5 min.

restriction
enzyme BtsCI used for digestion
of amplified PCR product (549 bp). BtsCI treated
PCR products were detected by
electrophoresis on a 2%
agarose gel, stained with ethidium bromide. It
cuts SNP site and produced four fragments of 46 and 76, 115 and 312 bp in normal state.it
has three Cutting positions in the mutant state and
produces 76, 115 and 358 bp fragments. The
heterozygous genotype produced six bands of 46, 76, 115, 312 and 358 bp.

x

Hi!
I'm Mack!

Would you like to get a custom essay? How about receiving a customized one?

Check it out